View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18890_low_15 (Length: 366)
Name: NF18890_low_15
Description: NF18890
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18890_low_15 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 325; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 325; E-Value: 0
Query Start/End: Original strand, 18 - 354
Target Start/End: Original strand, 3884128 - 3884464
Alignment:
| Q |
18 |
aacttaaagattaattcttatctatagtataccttggtacttacctttcatttcaccgcttgaatgttgtgttttgtaacatactatcataactgaattt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
3884128 |
aacttaaagattaattcttatctatagtataccttggtacttacctttcatttcaccgcttgaatgttgtgttttgcaacatactatcataactgaattt |
3884227 |
T |
|
| Q |
118 |
tgtttcattttagggacatgataaagatgttctttccatttgttgggatagaacgggaaagtatattgcctctgtcagtgaagattgtgcacgagtctgg |
217 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3884228 |
tgtttccttttagggacatgataaagatgttctttccatttgttgggatagaacgggaaagtatattgcctctgtcagtgaagattgtgcacgagtctgg |
3884327 |
T |
|
| Q |
218 |
tcggacggagaatgcatcggcgagttgcattcaaacgggaacaagtttcaatcgtgcatatttcatccgggatattgtaacctcttagttattggtggct |
317 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3884328 |
tcgaacggagaatgcatcggcgagttgcattcaaacgggaacaagtttcaatcgtgcatatttcatccgggatattgtaacctcttagttattggtggct |
3884427 |
T |
|
| Q |
318 |
atcaggtaagcccttcttccatcatgtgattgatatt |
354 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3884428 |
atcaggtaagcccttcttccatcatgtgattgatatt |
3884464 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 33; Significance: 0.000000002; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 35240846 - 35240794
Alignment:
| Q |
182 |
attgcctctgtcagtgaagattgtgcacgagtctggtcggacggagaatgcat |
234 |
Q |
| |
|
||||||||||||||||||||| || ||| ||||||||||||||| ||||||| |
|
|
| T |
35240846 |
attgcctctgtcagtgaagatgatgtacgtgtctggtcggacggacaatgcat |
35240794 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 182 - 220
Target Start/End: Complemental strand, 35237828 - 35237790
Alignment:
| Q |
182 |
attgcctctgtcagtgaagattgtgcacgagtctggtcg |
220 |
Q |
| |
|
||||||||||||| ||||||||||||||| ||||||||| |
|
|
| T |
35237828 |
attgcctctgtcactgaagattgtgcacgtgtctggtcg |
35237790 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University