View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18890_low_18 (Length: 315)
Name: NF18890_low_18
Description: NF18890
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18890_low_18 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 307; Significance: 1e-173; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 307; E-Value: 1e-173
Query Start/End: Original strand, 1 - 315
Target Start/End: Complemental strand, 53620950 - 53620636
Alignment:
| Q |
1 |
tcatcatttgacattgattcagaaggactaagaatccaagagatgcgttctaacttgatcaaagaatcatcgtgccaagaagatactcttttcaattttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53620950 |
tcatcatttgacattgattcagaaggactaagaatccaagagatgcgttctaacttgatcaaagaatcatcgtgccaagaagatactcttttcaattttt |
53620851 |
T |
|
| Q |
101 |
gacccaactcagaccatctggtggctttcttccagcgctgctcaaaattagttagtatatcatatgcagcaggcccttcgattttgcaatgtagatcatg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53620850 |
gacccaactcagaccatctggtggctttcttccagcgctgctcaaaattagttagtatatcatatgcagcaggcccttcgattttgcaatgtagatcatg |
53620751 |
T |
|
| Q |
201 |
ccatggttgccttggacccttggttccggcctattattaaaatggaagataaaaagaaacctcacttggtaagggagtacactggtgatctcaatctcaa |
300 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
53620750 |
ccatggttgccttggacccttggttcctgcctattattaaaatggaagataaaaagaaacctcacttggtaagagagtacactggtgatctcaatctcaa |
53620651 |
T |
|
| Q |
301 |
tatttaaaaaatctt |
315 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
53620650 |
tatttaaaaaatctt |
53620636 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 156 - 215
Target Start/End: Original strand, 36841068 - 36841127
Alignment:
| Q |
156 |
tatatcatatgcagcaggcccttcgattttgcaatgtagatcatgccatggttgccttgg |
215 |
Q |
| |
|
||||||||||||||| || ||||| ||||||||||||| |||||||||||||||||||| |
|
|
| T |
36841068 |
tatatcatatgcagccggaccttcaattttgcaatgtaagtcatgccatggttgccttgg |
36841127 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University