View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18890_low_20 (Length: 289)
Name: NF18890_low_20
Description: NF18890
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18890_low_20 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 102; Significance: 1e-50; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 73 - 186
Target Start/End: Complemental strand, 34667583 - 34667470
Alignment:
| Q |
73 |
tattacccttcacccaacaaatgcacttgtggaactagttttgtaatctcttctcccaattgctcttcatagtatgttgcttccacattcaacaacctgt |
172 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
34667583 |
tattacccttcacccagcaaatgcacttgtggaactatttttgtaatctcttctcccaattgctcttcatagtatgtttcttccacattcaacaacctgt |
34667484 |
T |
 |
| Q |
173 |
aaaatttcaaacat |
186 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
34667483 |
aaaatttcaaacat |
34667470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 15 - 53
Target Start/End: Complemental strand, 34667644 - 34667606
Alignment:
| Q |
15 |
aattagtacaaagctacttcacaccaattatatagttac |
53 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34667644 |
aattagtacaaagctacttcacaccaattatatagttac |
34667606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University