View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18890_low_25 (Length: 242)
Name: NF18890_low_25
Description: NF18890
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18890_low_25 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 48 - 242
Target Start/End: Original strand, 42715660 - 42715854
Alignment:
| Q |
48 |
ccaagaaagattaagaaatactttctctgagttttacactcttattaaggatatttggatccgatgataaaagttttcattcaacttaattataggtcct |
147 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42715660 |
ccaagaaagattaagaaatattttctctgagttttacactgttattaaggatatttggatccgatgataaaagttttcattcaacttaattataggtcct |
42715759 |
T |
 |
| Q |
148 |
tgatacgaatccaactttacattatgataaatcttttaaagaatagttttaccatcgattattgttccacccggttcaagaattttagaggatac |
242 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42715760 |
tgatacgaatccaactttacattatgataaatcttttaaagaatagttttaccatcgattattgttccacccggttcaagaattttagaggatac |
42715854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University