View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18891_high_13 (Length: 216)
Name: NF18891_high_13
Description: NF18891
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18891_high_13 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 18 - 200
Target Start/End: Complemental strand, 5106158 - 5105976
Alignment:
| Q |
18 |
tttttgcatgcacaattgataaaaattcaatctttaacatttatttgctatgttttttgttttaggttaaaaggggttgtgctgtttcatccaaaagtga |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5106158 |
tttttgcatgcacaattgataaaaattcaatctttaacatttatttgctatgttttttgttttaggttaaaaggggttgtgctgtttcatccaaaagtga |
5106059 |
T |
|
| Q |
118 |
aacctttaagctgattctgaacttggtttgttctgcaatgagggtttaagattgaattttttgttggggttttgatttatgat |
200 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5106058 |
aacctttaagctgattctgaacttgggttgttctgcaatgagggtttaagattgaattttttgttggggttttgatttatgat |
5105976 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University