View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18891_low_10 (Length: 282)
Name: NF18891_low_10
Description: NF18891
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18891_low_10 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 18 - 272
Target Start/End: Original strand, 48483013 - 48483266
Alignment:
| Q |
18 |
aaaaggaccccaataacttgagtaaaaagtgttttgtataagtcatattgggtaatgaaataacgttggggaatggaatgacnnnnnnnnnnnnnttata |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
48483013 |
aaaaggaccccaataacttgagtaaaaagtgttttgtataagtcatattgggtaatgaaataacgttggggaatggaatgacaaaaataaaaaaattata |
48483112 |
T |
|
| Q |
118 |
ttgtataattgtcattttttataccccctgacagaattcatttagttatcaaaacaagcatgcaaattagttcctagctactgctacaagaatattgcag |
217 |
Q |
| |
|
|||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48483113 |
ttgtatgattgtcattttttataccccccgacagaattcatttagttatcaaaacaagcatgcaaattagttcctagctactgctacaagaatattgcag |
48483212 |
T |
|
| Q |
218 |
gctagtagctaaaatcacctgacaacaaactgtcaagaaaaccttagcccctatg |
272 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
48483213 |
gctagtagctaaaatcacctgacaac-aactgtcaagaaaaccttagcccctatg |
48483266 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University