View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18891_low_11 (Length: 240)
Name: NF18891_low_11
Description: NF18891
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18891_low_11 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 134; Significance: 7e-70; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 1 - 134
Target Start/End: Complemental strand, 51947463 - 51947330
Alignment:
| Q |
1 |
atgaaaatagaaaatgaaagaagggaaagtaagaaagaacctgaaaccctatattagaagaattgattgtcgttgttgctgaacccaacgtttcttccat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51947463 |
atgaaaatagaaaatgaaagaagggaaagtaagaaagaacctgaaaccctatattagaagaattgattgtcgttgttgctgaacccaacgtttcttccat |
51947364 |
T |
 |
| Q |
101 |
ggctatggtatgaattcgcacaaacttaatctgc |
134 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
51947363 |
ggctatggtatgaattcgcacaaacttaatctgc |
51947330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University