View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18891_low_3 (Length: 510)
Name: NF18891_low_3
Description: NF18891
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18891_low_3 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 321; Significance: 0; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 321; E-Value: 0
Query Start/End: Original strand, 17 - 381
Target Start/End: Original strand, 36457560 - 36457924
Alignment:
| Q |
17 |
agtttagtggtttgtttggagttttatcagtggattggagtatcaattgtaactcatgtagatcctgtggttcatctgctgcagcataatgtgtctttat |
116 |
Q |
| |
|
||||| |||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36457560 |
agttttgtggtttggttggagttttatcagtggattggagtgtcaattgtaactcatgtagatcctgtggttcatctgctgcagcataatgtgtctttat |
36457659 |
T |
|
| Q |
117 |
ggggagtgaaaaacaaaaggctcgctcggtctgttgttgtggtgagcggttgtttgatctctatggattgctagaaataatataatttttatggacagta |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36457660 |
ggggagtgaaaaacaaaaggctcgctcggtctgttgttgtggtgagcggttgtttggtctctatggattgctagaaataatataatttttatggacagta |
36457759 |
T |
|
| Q |
217 |
ttcctaatgtgttcaatctcttagttggaaatggatgtcatcgaaaataggtagcagaccgaaaatgacattctgcggctggagtttatgctatttagaa |
316 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
36457760 |
ttcctaatgtgttcaatctcttagttggaaatgaatgtcgtcgaaaataggtagcagaccgaaaatgacattctctggctggagtttatgctatttagaa |
36457859 |
T |
|
| Q |
317 |
tgttatagaagttgaacattgtgtattggggttgagtacctcatgtactcatttgcatcttattt |
381 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||| |||||||||| |||||||||||| |
|
|
| T |
36457860 |
tgttataaaagttgaacattgtgtattggggttgagtaccttatgtactcatatgcatcttattt |
36457924 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 382 - 483
Target Start/End: Original strand, 36458064 - 36458164
Alignment:
| Q |
382 |
ttattttgaattagagcttgctataaattatttctatcacctaggaggagtatgccattggttggataataggctttcactttatgtggctctctatttc |
481 |
Q |
| |
|
|||||| || ||||||||| ||| |||||| || |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36458064 |
ttatttcgacttagagctt-ctacaaattacttgtatcacctaggaggagcatgccattggttggataataggctttcactttatgtggctctctatttc |
36458162 |
T |
|
| Q |
482 |
at |
483 |
Q |
| |
|
|| |
|
|
| T |
36458163 |
at |
36458164 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 51; Significance: 5e-20; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 39 - 129
Target Start/End: Complemental strand, 11629559 - 11629469
Alignment:
| Q |
39 |
tttatcagtggattggagtatcaattgtaactcatgtagatcctgtggttcatctgctgcagcataatgtgtctttatggggagtgaaaaa |
129 |
Q |
| |
|
||||||||||||||||||| || ||||||||| ||||||||| | |||| ||| ||||||| |||||||||||||| ||||| |||||||| |
|
|
| T |
11629559 |
tttatcagtggattggagtgtctattgtaacttatgtagatcttatggtacatttgctgcaccataatgtgtctttgtggggtgtgaaaaa |
11629469 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 148 - 227
Target Start/End: Complemental strand, 11628456 - 11628377
Alignment:
| Q |
148 |
tgttgttgtggtgagcggttgtttgatctctatggattgctagaaataatataatttttatggacagtattcctaatgtg |
227 |
Q |
| |
|
||||||||| | ||| ||||||||| ||||||| ||||||||||||||||||||||||||||||| |||| |||||||| |
|
|
| T |
11628456 |
tgttgttgttgggagaggttgtttggtctctatatattgctagaaataatataatttttatggacaatatttctaatgtg |
11628377 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University