View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18892_low_12 (Length: 239)
Name: NF18892_low_12
Description: NF18892
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18892_low_12 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 1 - 204
Target Start/End: Complemental strand, 2109416 - 2109213
Alignment:
| Q |
1 |
tgtgttatacgtcaaaatactacaaagggcattgtagtttttatgttacactttctggttgcgaatttcaacttttgttattcaaccagagatgaaaaac |
100 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||| | || ||||||||||| |
|
|
| T |
2109416 |
tgtgtcatacgtcaaaatactacaaagggcattgtagtttttatgttacactttgtgattgcgaatttcaacttttgttattcgatcaaagatgaaaaac |
2109317 |
T |
|
| Q |
101 |
attccgatgttcattcatcaaatgttttaagttcgtaaattttaaccattttctctcaaatgaagacattgttgcgattaataagatactttggttttcc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2109316 |
attccgatgttcattcatcaaatgttttaggttcgtaaattttaaccattttttcttaaatgaagacattgttgcgattaataagatactttggttttcc |
2109217 |
T |
|
| Q |
201 |
tctt |
204 |
Q |
| |
|
|||| |
|
|
| T |
2109216 |
tctt |
2109213 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 161 - 198
Target Start/End: Original strand, 1812121 - 1812158
Alignment:
| Q |
161 |
tgaagacattgttgcgattaataagatactttggtttt |
198 |
Q |
| |
|
||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
1812121 |
tgaagacattgttgcgaataataagataatttggtttt |
1812158 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University