View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18893_low_15 (Length: 314)
Name: NF18893_low_15
Description: NF18893
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18893_low_15 |
 | |
|
| [»] scaffold1333 (3 HSPs) |
| | |
|
Alignment Details
Target: scaffold1333 (Bit Score: 69; Significance: 6e-31; HSPs: 3)
Name: scaffold1333
Description:
Target: scaffold1333; HSP #1
Raw Score: 69; E-Value: 6e-31
Query Start/End: Original strand, 17 - 89
Target Start/End: Original strand, 1105 - 1177
Alignment:
| Q |
17 |
atgaacttggaactcaaagagaaactatatttattttgtgagattatggaagatgagtacacaataaatttat |
89 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1105 |
atgaacttggaactcaaagaggaactatatttattttgtgagattatggaagatgagtacacaataaatttat |
1177 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1333; HSP #2
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 190 - 230
Target Start/End: Original strand, 1174 - 1214
Alignment:
| Q |
190 |
ttatctgacacatggtttaatctgtgtcttttaagaagcat |
230 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
1174 |
ttatctgacacatggtttaatctctgtcttttaagaagcat |
1214 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1333; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 263 - 295
Target Start/End: Original strand, 1226 - 1258
Alignment:
| Q |
263 |
ccatcactattttgcattttaattcgcttattg |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
1226 |
ccatcactattttgcattttaattcgcttattg |
1258 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University