View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18893_low_18 (Length: 213)
Name: NF18893_low_18
Description: NF18893
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18893_low_18 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 139; Significance: 6e-73; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 139; E-Value: 6e-73
Query Start/End: Original strand, 46 - 188
Target Start/End: Complemental strand, 24628382 - 24628240
Alignment:
| Q |
46 |
gttaagtcttgcatgcaaaccattacagtccaactaattcttccttcaatcattcatgtcaactacaattcagattctcactcctttcttctcaactagt |
145 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24628382 |
gttaagtcttgcatgcaaaccattacagtccaactaattcttccttcaatcattcatgtcaactacaattcagattctcactcctttcttctcaactagt |
24628283 |
T |
|
| Q |
146 |
agaaaagggttaatagaagcactccttcatctcctatgattct |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
24628282 |
agaaaagggttaatagaagcactccttcatctcttatgattct |
24628240 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University