View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18894_high_15 (Length: 248)
Name: NF18894_high_15
Description: NF18894
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18894_high_15 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 19 - 248
Target Start/End: Original strand, 12921579 - 12921808
Alignment:
| Q |
19 |
agtagaagcaaaaaattgtgtcccttcttgcnnnnnnncttctaatttcataacaaaactcccttttacactttttgctaagcaaggttagtgctgcaaa |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12921579 |
agtagaagcaaaaaattgtgtcccttcttgctttttttcttctaatttcataacaaagctcccttttacactttttgctaagcaaggttagtgctgcaaa |
12921678 |
T |
 |
| Q |
119 |
cataagaaggccaattccatgtcttctaatttctcttttttgattatggtgaattggctggatctaactgacctaaatttgnnnnnnnnngagggattaa |
218 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
12921679 |
cataagaaggccaattccatttcttctaatttctcttttttgattatggtgaattggctggatctaactgacctaaatttgtttttttttgagggattaa |
12921778 |
T |
 |
| Q |
219 |
ttttatttttatatagcaaaaatcttcact |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
12921779 |
ttttatttttatatagcaaaaatcttcact |
12921808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University