View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18894_low_16 (Length: 254)
Name: NF18894_low_16
Description: NF18894
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18894_low_16 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 153; Significance: 3e-81; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 13 - 235
Target Start/End: Original strand, 11296517 - 11296735
Alignment:
| Q |
13 |
aatatactcttgacatcatgaaagaaactggactagttgcagccaatcccgcctccactccactcccacgcgtaaaggaacctaacttctcaaagactct |
112 |
Q |
| |
|
||||||| ||||||||||||| ||||||| |||||||||||||||| |||||||||||||| || ||||||||||||||||||||||||||||||| |
|
|
| T |
11296517 |
aatatacgcttgacatcatgacagaaacttgactagttgcagccaagcccgcctccactcc-----catgcgtaaaggaacctaacttctcaaagactct |
11296611 |
T |
 |
| Q |
113 |
ggcaccattctt---actgatcccatgatgtctacagaagactcgtcggcaaactcatctatttgcgcgaattcaagatgcatcagttggcaactgtttt |
209 |
Q |
| |
|
|||||||||||| |||||||| |||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
11296612 |
ggcaccattcttcttactgatcc--tgatgtctacagaagactcgtcggcaaattcatctatttgctcgaattcaagatgcatcagttggcaactgtttt |
11296709 |
T |
 |
| Q |
210 |
tggcagtttctttgaaaatcagtgcc |
235 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
11296710 |
tggcagtttctttgaaaatcagtgcc |
11296735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 188 - 228
Target Start/End: Original strand, 33491285 - 33491325
Alignment:
| Q |
188 |
tgcatcagttggcaactgtttttggcagtttctttgaaaat |
228 |
Q |
| |
|
|||||||||||||||||||||| || ||||||||||||||| |
|
|
| T |
33491285 |
tgcatcagttggcaactgttttaggtagtttctttgaaaat |
33491325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University