View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18895_low_3 (Length: 312)
Name: NF18895_low_3
Description: NF18895
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18895_low_3 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 272; Significance: 1e-152; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 272; E-Value: 1e-152
Query Start/End: Original strand, 19 - 298
Target Start/End: Original strand, 41924254 - 41924533
Alignment:
| Q |
19 |
ttaatacgcttattgatgggtattgtaaggtgggtggaatagacgaagcttttagattgagggctaggatgaatggtccgtattcgaaggctaatgttgt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41924254 |
ttaatacgcttattgatgggtattgtaaggtgggtggaatagacgaagcttttagattgagggctaggatgaatggtccgtattcgaaggctaatgttgt |
41924353 |
T |
 |
| Q |
119 |
tacttacaattgcttgttaagtggtctttgtggtttggggagattggaagatgctaagagggtgttgttggagatggaaaggaaaggttttttgcctggg |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
41924354 |
tacttacaattgcttgttaagtggtctttgtggtttggggagattggaagatgctaagagggtgttgttggagatggaaaggaaaggttttttgcctagg |
41924453 |
T |
 |
| Q |
219 |
gggttttcgagtcttgtatttgatgatcagttgatgggtggaaatgaaaatggtttgttaaatggaaatggaacacaggt |
298 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41924454 |
gggttttcgagtcttgtatttgatgatcagttgatgagtggaaatgaaaatggtttgttaaatggaaatggaacacaggt |
41924533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University