View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18895_low_4 (Length: 272)
Name: NF18895_low_4
Description: NF18895
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18895_low_4 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 171; Significance: 7e-92; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 171; E-Value: 7e-92
Query Start/End: Original strand, 58 - 254
Target Start/End: Complemental strand, 39028178 - 39027978
Alignment:
| Q |
58 |
aataagcaaggctt-cctttgtaaaactgcagaatttggatgatttatta---caaagttacaatgatgacttccaattcatcaattatgaattatagaa |
153 |
Q |
| |
|
|||||| ||||||| ||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39028178 |
aataaggaaggctttcctttgtaaaactgcagaattaggatgatttattattacaaagttacaatgatgacttccaattcatcaattatgaattatagaa |
39028079 |
T |
 |
| Q |
154 |
ataaattctactattatgattatcatatgataatatataaatctaattactatggattgagtctaatggagttagatttccacaacccaacataccaaga |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39028078 |
ataaattctactattatgattatcatatgataatatataaatctaattactatggattgagtctaatggagttagatttccacaacccaacataccaaga |
39027979 |
T |
 |
| Q |
254 |
t |
254 |
Q |
| |
|
| |
|
|
| T |
39027978 |
t |
39027978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University