View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18896_low_14 (Length: 272)
Name: NF18896_low_14
Description: NF18896
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18896_low_14 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 97 - 257
Target Start/End: Complemental strand, 26615505 - 26615347
Alignment:
| Q |
97 |
tattatttgaacagtcgagcttaggttttaatataggtaaacttgtggcttgggttatatagtttgatgatggcttgataagcagttgtttgttgctttc |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26615505 |
tattatttgaacagtcgagcttaggttttaatataggtaaacttgtggcttgggttatatagtttgatgatggcttgataagcagttgtttgttgctttc |
26615406 |
T |
 |
| Q |
197 |
ttcggcaatactcaataccataaaaatatctatgtatatgcttcttgaccaaagtttaatt |
257 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
26615405 |
ttcggcaatactcaataccataaaa--atctatgtatatgcttcttgaccaaagtttaatt |
26615347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University