View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18897_high_10 (Length: 430)
Name: NF18897_high_10
Description: NF18897
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18897_high_10 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 153; Significance: 6e-81; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 153; E-Value: 6e-81
Query Start/End: Original strand, 13 - 201
Target Start/End: Original strand, 23056904 - 23057092
Alignment:
| Q |
13 |
gagaagaagataaggtggtggtggtatgaccagagaagaaaaggaggcaaggtggttggagaagatgaggtggggtggtgaggatggaagagtttgagta |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| | |||||||| |
|
|
| T |
23056904 |
gagaagaagataaggtggtggtggtatgaccagagaagaaaaggaggcaaggtggtcggagaagatgaggtggggtggtgaggatggaaaaatttgagta |
23057003 |
T |
 |
| Q |
113 |
gattcgatggtgggggtgaacgacggtggtgaggagaaggatgggtgatgatggtgtttgattcagtgggtatggtggccagtgagggt |
201 |
Q |
| |
|
||| || |||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||| |||||||| ||||||| |
|
|
| T |
23057004 |
gatccggtggtgggggtgaacgacggtggtgaggagaaggatgagtgatgatggtgtttgattcggtgggtacggtggccaatgagggt |
23057092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 93; E-Value: 4e-45
Query Start/End: Original strand, 278 - 382
Target Start/End: Original strand, 23057169 - 23057273
Alignment:
| Q |
278 |
ttgttgagtgtttgtgtcaacaacatatttagaaatttcaacttgagagggcaagatcatgtacacacaaactcaagataaaatgatgatattgttatct |
377 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||| ||||||| |
|
|
| T |
23057169 |
ttgttgagtgtttgtgtcaacaacatatttagaaatttcaacttgagagggcaagatcatttatacacaaactcaagataaaatgatgatatcgttatct |
23057268 |
T |
 |
| Q |
378 |
ttgac |
382 |
Q |
| |
|
||||| |
|
|
| T |
23057269 |
ttgac |
23057273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 47; Significance: 1e-17; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 64 - 162
Target Start/End: Complemental strand, 38336909 - 38336812
Alignment:
| Q |
64 |
gtggttggagaagatgaggtggggtggtgaggatggaagagtttgagtagattcgatggtgggggtgaacgacggtggtgaggagaaggatgggtgatg |
162 |
Q |
| |
|
|||||| || || ||||||||||||||||| |||||| ||||||||| ||||||||||||| |||||| ||||||||| ||||||||||||||||| |
|
|
| T |
38336909 |
gtggttagaaaatatgaggtggggtggtgatgatggattgatttgagtagtttcgatggtgggg-tgaacggcggtggtgaagagaaggatgggtgatg |
38336812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University