View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18898_high_24 (Length: 227)

Name: NF18898_high_24
Description: NF18898
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18898_high_24
NF18898_high_24
[»] chr1 (2 HSPs)
chr1 (7-84)||(48020027-48020104)
chr1 (179-227)||(48020198-48020246)


Alignment Details
Target: chr1 (Bit Score: 78; Significance: 2e-36; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 7 - 84
Target Start/End: Original strand, 48020027 - 48020104
Alignment:
7 atgtctgcaacagagtgttgattccagcaacaaaaagcagtgtttgaatcatttcagctttttccacctacagttttc 84  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
48020027 atgtctgcaacagagtgttgattccagcaacaaaaagcagtgtttgaatcatttcagctttttccacctacagttttc 48020104  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 179 - 227
Target Start/End: Original strand, 48020198 - 48020246
Alignment:
179 ttgatgattacattgccaccacccatcaaaggaacaagaatagtggaaa 227  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||    
48020198 ttgatgattacattgccaccacccatcaaaggaacaagaatagtggaaa 48020246  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University