View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18898_high_30 (Length: 203)
Name: NF18898_high_30
Description: NF18898
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18898_high_30 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 159; Significance: 7e-85; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 159; E-Value: 7e-85
Query Start/End: Original strand, 18 - 188
Target Start/End: Complemental strand, 3816438 - 3816268
Alignment:
| Q |
18 |
tacttcgaagtgcgactctattttggttgaaattttgagctattttcaatagtccatcttcaaataacacttggcaattgccttattttaatgtccattt |
117 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
3816438 |
tacttcaaagtgcgactctattttggttgaaattttgagctattttcaatagtccatcttcaaataacacttggcaattgccttagtttaatgtccattt |
3816339 |
T |
 |
| Q |
118 |
acgcatctcaatgttttggattgctcttgatgaatttttagtttcctgacacaaaagtgcagtgtgacaga |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
3816338 |
acgcatctcaatgttttggattgctcttgatgaattttgagtttcctgacacaaaagtgcagtgtgacaga |
3816268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University