View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18898_high_30 (Length: 203)

Name: NF18898_high_30
Description: NF18898
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18898_high_30
NF18898_high_30
[»] chr5 (1 HSPs)
chr5 (18-188)||(3816268-3816438)


Alignment Details
Target: chr5 (Bit Score: 159; Significance: 7e-85; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 159; E-Value: 7e-85
Query Start/End: Original strand, 18 - 188
Target Start/End: Complemental strand, 3816438 - 3816268
Alignment:
18 tacttcgaagtgcgactctattttggttgaaattttgagctattttcaatagtccatcttcaaataacacttggcaattgccttattttaatgtccattt 117  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||    
3816438 tacttcaaagtgcgactctattttggttgaaattttgagctattttcaatagtccatcttcaaataacacttggcaattgccttagtttaatgtccattt 3816339  T
118 acgcatctcaatgttttggattgctcttgatgaatttttagtttcctgacacaaaagtgcagtgtgacaga 188  Q
    |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||    
3816338 acgcatctcaatgttttggattgctcttgatgaattttgagtttcctgacacaaaagtgcagtgtgacaga 3816268  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University