View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18898_low_11 (Length: 380)
Name: NF18898_low_11
Description: NF18898
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18898_low_11 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 311; Significance: 1e-175; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 311; E-Value: 1e-175
Query Start/End: Original strand, 1 - 374
Target Start/End: Original strand, 48579361 - 48579720
Alignment:
| Q |
1 |
tggtgaccattaaatcgagataggatggtgtgatttgaggtgcagccttttttcagcggtgtacctgtaaacttggcacaaatttcgcaaagttgaaatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
48579361 |
tggtgaccattaaatcgagataggatagtgtgatttgaggtgcagccttttttcagcggtgtacctgtaaacttggcacaaat--------------att |
48579446 |
T |
 |
| Q |
101 |
gaagctgtccaattaagattgcatagtaagatcacgggactatcttgactgaatgactttgggcacacataatttttaagatatggagaattgattttgg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48579447 |
gaagctgtccaattaagattgcatagtaagatcacgtgactatcttgactgaatgactttgggcacacataatttttaagatatggagaattgattttgg |
48579546 |
T |
 |
| Q |
201 |
ataaaaataattcttactaaattttagtaataaatttaggaaaatgctagatctcttcaaaatctgtttcacgagagcctagcgaatgacgtggaacggt |
300 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48579547 |
ataaaaataattcttactaaattttagttataaatttaggaaaatgctagatctctccaaaatctgtttcacgagagcctagcgaatgacgtggaacggt |
48579646 |
T |
 |
| Q |
301 |
catttgcgttttacagcttctctctcaagtcagtcttccctttcttttccttcaaagtttcacactcttcatat |
374 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48579647 |
catttgcgttttacagcttctctctcaagtcagtcttccctttcttttccttcaaagtttcacactcttcatat |
48579720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University