View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18899_low_17 (Length: 272)
Name: NF18899_low_17
Description: NF18899
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18899_low_17 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 113; Significance: 3e-57; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 113; E-Value: 3e-57
Query Start/End: Original strand, 19 - 143
Target Start/End: Original strand, 43614911 - 43615035
Alignment:
| Q |
19 |
ctttagctagtttttactcatctctgagttgaactcaaatcactcgaactaattttttctaaaagttggagggttaaaaataaaagaactatcataaata |
118 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43614911 |
ctttagctagtttttactcatctttgagttgaactcaaatcacttgaactaattttttctaaaagttggagggttaaaaataaaagaactatcataaata |
43615010 |
T |
 |
| Q |
119 |
aaagaagtagtagtactagagcaac |
143 |
Q |
| |
|
||||||| ||||||||||||||||| |
|
|
| T |
43615011 |
aaagaagcagtagtactagagcaac |
43615035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 67; E-Value: 8e-30
Query Start/End: Original strand, 185 - 263
Target Start/End: Original strand, 43615077 - 43615155
Alignment:
| Q |
185 |
agtttggaccagagccagcatgtaacatggagtatctgttgaacatcgcactgtaaactgtgactgtgtgaagaataat |
263 |
Q |
| |
|
||||||||||||||| |||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
43615077 |
agtttggaccagagctagcatgtaacatggtgtatctgttgaacatcgcactgtaaagtgtgactgtgtgaagaataat |
43615155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University