View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18899_low_19 (Length: 264)
Name: NF18899_low_19
Description: NF18899
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18899_low_19 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 10 - 247
Target Start/End: Original strand, 46969105 - 46969344
Alignment:
| Q |
10 |
attattctataacactatgagtgtccaagtttcaatttttaaaacaccctttgtgatttcactagattatttatttccatnnnnnnnnn--tcatggcaa |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||| ||||||||| |
|
|
| T |
46969105 |
attattctataacactatgagtgtccaagtttcaatttttataacaccctttgtgatttcactaggttatttatttccataaaaaaaaaaatcatggcaa |
46969204 |
T |
 |
| Q |
108 |
ttcaactttatcgagtatagttgatatttacttataaatgtacatgtggatcaagcaaaacaagtatttctatacaaggggcccattgataatataatgg |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46969205 |
ttcaactttatcgagtatagttgatatttacttataaatgtacaggtggatcaagcaaaacaagtatttctatacaaggggcccattgataatataatgg |
46969304 |
T |
 |
| Q |
208 |
aacgacaacatctttgtcatctgtgatgtaggtaacattt |
247 |
Q |
| |
|
|||| |||||||||||||||| ||||||||| |||||||| |
|
|
| T |
46969305 |
aacggcaacatctttgtcatcagtgatgtagctaacattt |
46969344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University