View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18899_low_24 (Length: 224)
Name: NF18899_low_24
Description: NF18899
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18899_low_24 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 1 - 202
Target Start/End: Original strand, 19378174 - 19378375
Alignment:
| Q |
1 |
atgtgaaactgttcaaaaagaaagttcaatgacttttggtatttataggatttgctacatgaatagataaaaaacagaatatatgtgaatccatttaata |
100 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19378174 |
atgtgaaactgttcaaagagaaagttcaatgacttttggtatttataggatttgctacaagtatagataaaaaacagaatatatgtgaatccatttaata |
19378273 |
T |
|
| Q |
101 |
tcattgtaaatcgattacttatttgatggtaagataacttcaaaaatgtttcaaagcatttcgaagtgttttgattatgtttctaacatgcatatatctt |
200 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19378274 |
tcattgtgaatcgattacttatttgatggtaagatgacttcaaaaatgtttcaaagcagttcgaagtgttttgattatgtttctaacatgcatatatctt |
19378373 |
T |
|
| Q |
201 |
aa |
202 |
Q |
| |
|
|| |
|
|
| T |
19378374 |
aa |
19378375 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University