View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18901_high_26 (Length: 242)
Name: NF18901_high_26
Description: NF18901
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18901_high_26 |
 |  |
|
| [»] chr4 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 192; Significance: 1e-104; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 28 - 242
Target Start/End: Original strand, 54218942 - 54219154
Alignment:
| Q |
28 |
aaaaaaggaaattcagtgaaatttgaagacgcaacttcccaggcctaaagattgcacgtggttcctcacatcagtcagcttcttcaaatttgatgataaa |
127 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54218942 |
aaaaaaggaaattcagtgaaatttgaagacgcaacttcccaggcctaaagattgcacgtggttcctcacatcagtcagcttcttcaaatttgatgataaa |
54219041 |
T |
 |
| Q |
128 |
cctccggaacaaaatatgttgatctcctctagaactgtgtgccattttctgtcaaacactttaccaattggatttcaatttcatctccatcaaaatctga |
227 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
54219042 |
cctccggaacaaaatatgttgatcgcctctagaac--tgtggcattttctgtcaaacactttaacaattggatttcaatttcatctccatcaaaatctga |
54219139 |
T |
 |
| Q |
228 |
aaaagaacataattt |
242 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
54219140 |
aaaagaacataattt |
54219154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 59 - 112
Target Start/End: Original strand, 31217373 - 31217426
Alignment:
| Q |
59 |
caacttcccaggcctaaagattgcacgtggttcctcacatcagtcagcttcttc |
112 |
Q |
| |
|
|||||||||| |||||||| ||||| |||||||||||||||| |||||||||| |
|
|
| T |
31217373 |
caacttcccatgcctaaagcttgcaattggttcctcacatcagccagcttcttc |
31217426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University