View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18901_high_27 (Length: 240)
Name: NF18901_high_27
Description: NF18901
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18901_high_27 |
 | |
|
| [»] scaffold0179 (2 HSPs) |
| | |
|
Alignment Details
Target: scaffold0179 (Bit Score: 65; Significance: 1e-28; HSPs: 2)
Name: scaffold0179
Description:
Target: scaffold0179; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 36 - 144
Target Start/End: Original strand, 6462 - 6570
Alignment:
| Q |
36 |
tccattcctctcctttctcctctaggataannnnnnnncttctccttttcgcttactaatctttttatagactctatcaatgaatccaccactctcaaca |
135 |
Q |
| |
|
||||| ||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
6462 |
tccatccctctcctttctcctctaggatattttttttccttctccttttcgcttattaatctttttatagactctatgaatgaatccaccactctcaaca |
6561 |
T |
|
| Q |
136 |
ccctgaaaa |
144 |
Q |
| |
|
|||| |||| |
|
|
| T |
6562 |
ccctcaaaa |
6570 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0179; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 202 - 239
Target Start/End: Original strand, 6629 - 6666
Alignment:
| Q |
202 |
gggtgtttgattattggtgaatttgtgtctgtgctgct |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
6629 |
gggtgtttgattattggtgaatttgtgtctgtgttgct |
6666 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University