View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18901_high_35 (Length: 214)
Name: NF18901_high_35
Description: NF18901
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18901_high_35 |
 |  |
|
| [»] chr7 (2 HSPs) |
 |  |
|
| [»] chr5 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 194; Significance: 1e-105; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 1 - 214
Target Start/End: Complemental strand, 28104083 - 28103870
Alignment:
| Q |
1 |
ttcagctactcattttacatacaattgtgcatcccatcttcacgatattcatggaagagaaagatataggaaagagcaattggagtaatgagaacctgga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28104083 |
ttcagctactcattttacatacaattgtgcatcccatcttcacaatattcatggaagagaaagatataggaaagagcaattggagtaatgagaacctgga |
28103984 |
T |
 |
| Q |
101 |
aaccaataaattaaacctgcattgtggtgagtagataagtttaagtcagtgagcctaattacttttatgggggctaaaacatactccctccatctcacaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||| ||||||||||| |||||||| |
|
|
| T |
28103983 |
aaccaataaattaaacctgcattgtggtgagtagataagtttaagttagtgaacctaattacttttatgggggctaaaaaatactccctccgtctcacaa |
28103884 |
T |
 |
| Q |
201 |
tatttgtcgtttaa |
214 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
28103883 |
tatttgtcgtttaa |
28103870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 182 - 214
Target Start/End: Complemental strand, 5524549 - 5524517
Alignment:
| Q |
182 |
tactccctccatctcacaatatttgtcgtttaa |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
5524549 |
tactccctccatctcacaatatttgtcgtttaa |
5524517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 135 - 175
Target Start/End: Original strand, 6939518 - 6939558
Alignment:
| Q |
135 |
ataagtttaagtcagtgagcctaattacttttatgggggct |
175 |
Q |
| |
|
|||||| ||||| |||||||||||||| ||||||||||||| |
|
|
| T |
6939518 |
ataagtgtaagttagtgagcctaattaattttatgggggct |
6939558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000003; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 182 - 214
Target Start/End: Complemental strand, 4818713 - 4818681
Alignment:
| Q |
182 |
tactccctccatctcacaatatttgtcgtttaa |
214 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
4818713 |
tactccctccgtctcacaatatttgtcgtttaa |
4818681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 182 - 214
Target Start/End: Original strand, 40530175 - 40530207
Alignment:
| Q |
182 |
tactccctccatctcacaatatttgtcgtttaa |
214 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
40530175 |
tactccctccgtctcacaatatttgtcgtttaa |
40530207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University