View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18901_low_17 (Length: 279)
Name: NF18901_low_17
Description: NF18901
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18901_low_17 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 12 - 259
Target Start/End: Original strand, 34124240 - 34124487
Alignment:
| Q |
12 |
atgaaaacaagaggtagaaaataaaagataaacaagtgattatggaaggagaaagaaataaaaagtagaggagagtaaatatatgagggagggagggagg |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34124240 |
atgaaaacaagaggtagaaaataaaagataaacaagtgattatggaaggagaaagaaataaaaagtagaggagagtaaatatatgagggagggagggagg |
34124339 |
T |
|
| Q |
112 |
aagactgaatgaagaatgcaatggattgggtagggaagtagtaattaatttatagatggttagtatttattgtatgaataagtgaataactactagttta |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
34124340 |
aagactgaatgaagaatgcaatggattgggtagggaagtagtaattaatttatagatggttagtaattattgtatgaataagtgaataactactagttta |
34124439 |
T |
|
| Q |
212 |
cttgtttttcatattgaaaagtgaatgaattattggtaggtagctact |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34124440 |
cttgtttttcatattgaaaagtgaatgaattattggtaggtagctact |
34124487 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University