View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18901_low_18 (Length: 271)
Name: NF18901_low_18
Description: NF18901
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18901_low_18 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 117; Significance: 1e-59; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 122 - 259
Target Start/End: Complemental strand, 22327790 - 22327653
Alignment:
| Q |
122 |
ctcccatctttcttgcatattcgatggaagagaaagataatgatgttggtggattagggtgtggtagtggtggaagaaaagaagaccgnnnnnnnggtgg |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
22327790 |
ctcccatctttcttgcatattcgatggaagagaaagataatgatgttggtggattagggtgtggtagtggtggaagaaaagaagaccgtttttttggtgg |
22327691 |
T |
 |
| Q |
222 |
ttcaagtgactctggttgtggttctaaatctagatatt |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22327690 |
ttcaagtgactctggttgtggttctaaatctagatatt |
22327653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 1 - 51
Target Start/End: Complemental strand, 22327911 - 22327861
Alignment:
| Q |
1 |
acctccacgatttctcctcctcctccgctgctgctgattctcttcgacgag |
51 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22327911 |
acctccacgatttctcctcctcctccgctgctgctgattctcttcgacgag |
22327861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University