View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18901_low_25 (Length: 245)

Name: NF18901_low_25
Description: NF18901
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18901_low_25
NF18901_low_25
[»] chr7 (2 HSPs)
chr7 (153-231)||(32539389-32539460)
chr7 (73-119)||(32539457-32539503)


Alignment Details
Target: chr7 (Bit Score: 48; Significance: 2e-18; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 153 - 231
Target Start/End: Complemental strand, 32539460 - 32539389
Alignment:
153 gaagtaaattaaatacccaagtttgtaatattatatgatgaaaaagaaatgcttatatatgttagggacatgtgaaggg 231  Q
    ||||||||||||||||||||||||||||   ||||||||||||||||||||||    ||||||||||||||||||||||    
32539460 gaagtaaattaaatacccaagtttgtaa---tatatgatgaaaaagaaatgct----tatgttagggacatgtgaaggg 32539389  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 73 - 119
Target Start/End: Complemental strand, 32539503 - 32539457
Alignment:
73 aaattggttttatgagaagttaagacaataattagggaatagcgaag 119  Q
    |||||||||||||| ||||||||||||||||||||||||||||||||    
32539503 aaattggttttatgtgaagttaagacaataattagggaatagcgaag 32539457  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University