View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18901_low_28 (Length: 239)
Name: NF18901_low_28
Description: NF18901
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18901_low_28 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 17 - 239
Target Start/End: Complemental strand, 22882945 - 22882724
Alignment:
| Q |
17 |
atgaatccatcaatcaatctaccccttttcacaaaaggatctttattcttcaatgttccatcaaagcnnnnnnnnntgttgaattgtgatggattcaaca |
116 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
22882945 |
atgaatccatcaatcaatcaaccccttttcacaaaaggatctttattcttcaatgttccatcaaagcaaaaaaaa-tgttgaattgtgatggattcaaca |
22882847 |
T |
|
| Q |
117 |
taacacaacacagatctcttggaattggaattgctcaattttcaggtactgctcttatcttttgattacattttatgttagatttgctaaattatgtggt |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22882846 |
taacacaacacagatctcttggaattggaattgctcaattttcaggtactgctcttatcttttgattacattttatgttagatttgctaaattatgtggt |
22882747 |
T |
|
| Q |
217 |
ctctgattgtttagatttgctat |
239 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
22882746 |
ctctgattgtttagatttgctat |
22882724 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University