View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18901_low_29 (Length: 235)
Name: NF18901_low_29
Description: NF18901
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18901_low_29 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 63 - 221
Target Start/End: Original strand, 26405070 - 26405226
Alignment:
| Q |
63 |
tcgtgcttgataaattatgcagaaaatgttaaagatgcataagataacacgcgagaaggttaataaaccaatattttatatcactaaacatgatcctcca |
162 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
26405070 |
tcgtgcttgataaattatgcagaaaatgttaaagatgcataagataacacgcaagaaggttaataaa-caatattttatatcactaaacatgatcctcca |
26405168 |
T |
 |
| Q |
163 |
gagacgtttaaccagtaaatcatgtagaaaataagcagcttattaatccaggaaaaagt |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||| |
|
|
| T |
26405169 |
gagacgtttaaccagtaaatcatgtagaaaa-aagcagtttattaatccaggaaaaagt |
26405226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University