View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18903_low_23 (Length: 223)
Name: NF18903_low_23
Description: NF18903
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18903_low_23 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 101; Significance: 3e-50; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 105 - 205
Target Start/End: Original strand, 24404157 - 24404257
Alignment:
| Q |
105 |
ccctatcttagaagaccgtccattggattccataaccattcatagagcaagcatggaaggttcttcaacctgtgtaaattccattgccagaacaacactt |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24404157 |
ccctatcttagaagaccgtccattggattccataaccattcatagagcaagcatggaaggttcttcaacctgtgtaaattccattgccagaacaacactt |
24404256 |
T |
 |
| Q |
205 |
t |
205 |
Q |
| |
|
| |
|
|
| T |
24404257 |
t |
24404257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 45; Significance: 8e-17; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 105 - 205
Target Start/End: Original strand, 35846368 - 35846468
Alignment:
| Q |
105 |
ccctatcttagaagaccgtccattggattccataaccattcatagagcaagcatggaaggttcttcaacctgtgtaaattccattgccagaacaacactt |
204 |
Q |
| |
|
|||||||| ||||||| |||| |||||||| ||| |||||||||||||| | ||||| || |||||| ||| |||||| |||||| |||| ||||||||| |
|
|
| T |
35846368 |
ccctatctaagaagacagtcccttggattcaatagccattcatagagcaggtatggaggggtcttcagcctctgtaaactccattaccaggacaacactt |
35846467 |
T |
 |
| Q |
205 |
t |
205 |
Q |
| |
|
| |
|
|
| T |
35846468 |
t |
35846468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University