View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18904_low_6 (Length: 233)

Name: NF18904_low_6
Description: NF18904
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18904_low_6
NF18904_low_6
[»] chr4 (1 HSPs)
chr4 (3-218)||(1597769-1597984)


Alignment Details
Target: chr4 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 3 - 218
Target Start/End: Complemental strand, 1597984 - 1597769
Alignment:
3 actcgcggaaacaaaattttgtgcagtcacggacttgatggaagtctgcaaaaaatatagtacatatcaagccattgaagaacttcatgtcacatccgaa 102  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1597984 actcgcggaaacaaaattttgtgcagtcacggacttgatggaagtctgcaaaaaatatagtacatatcaagccattgaagaacttcatgtcacatccgaa 1597885  T
103 cgggagtgcgtgagagttttggatcaagagaagtaaatagtcacttaaatttgccaaacgaaactacacaaaagagagcatactaatactagaaactgat 202  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1597884 cgggagtgcgtgagagttttggatcaagagaagtaaatagtcacttaaatttgccaaacgaaactacacaaaagagagcatactaatactagaaactgat 1597785  T
203 gtgaacatgaaattag 218  Q
    ||||||||||||||||    
1597784 gtgaacatgaaattag 1597769  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University