View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18904_low_6 (Length: 233)
Name: NF18904_low_6
Description: NF18904
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18904_low_6 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 3 - 218
Target Start/End: Complemental strand, 1597984 - 1597769
Alignment:
| Q |
3 |
actcgcggaaacaaaattttgtgcagtcacggacttgatggaagtctgcaaaaaatatagtacatatcaagccattgaagaacttcatgtcacatccgaa |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1597984 |
actcgcggaaacaaaattttgtgcagtcacggacttgatggaagtctgcaaaaaatatagtacatatcaagccattgaagaacttcatgtcacatccgaa |
1597885 |
T |
|
| Q |
103 |
cgggagtgcgtgagagttttggatcaagagaagtaaatagtcacttaaatttgccaaacgaaactacacaaaagagagcatactaatactagaaactgat |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1597884 |
cgggagtgcgtgagagttttggatcaagagaagtaaatagtcacttaaatttgccaaacgaaactacacaaaagagagcatactaatactagaaactgat |
1597785 |
T |
|
| Q |
203 |
gtgaacatgaaattag |
218 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
1597784 |
gtgaacatgaaattag |
1597769 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University