View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18905_high_8 (Length: 249)
Name: NF18905_high_8
Description: NF18905
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18905_high_8 |
 |  |
|
| [»] scaffold0042 (1 HSPs) |
 |  |  |
|
| [»] scaffold0502 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr1 (Bit Score: 215; Significance: 1e-118; HSPs: 5)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 12 - 246
Target Start/End: Original strand, 14758910 - 14759144
Alignment:
| Q |
12 |
aatatcaattaatcttgataaatttttaatcattagttagttcattcatatacatgaattgttaccatgcgcaggtaacacgcctcaagtgtggtggttt |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14758910 |
aatatcaattaatcttgataaatttttaatcattagttagttcattcatatacatgaattgttaccatgcgcaggtaacacgcctcaagtgtggtggttt |
14759009 |
T |
 |
| Q |
112 |
catttttgctttccgtatgaaccatacaatgagtgatggatcaggtatgcttcaattcttgaatgccttaggagagatatctcgtgggatgagcaaacct |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||| |
|
|
| T |
14759010 |
catttttgctttccgtatgaaccatacaatgagtgatggatcaggtatgcttcaattcttgaatgccttaggagaaatatctcgtgggatgagtaaacct |
14759109 |
T |
 |
| Q |
212 |
tcaatctcaccggtgtggtgtagagagcttcttaa |
246 |
Q |
| |
|
||||||||||| |||||| | |||||||||||||| |
|
|
| T |
14759110 |
tcaatctcaccagtgtggagcagagagcttcttaa |
14759144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 82 - 246
Target Start/End: Complemental strand, 14878759 - 14878595
Alignment:
| Q |
82 |
gcaggtaacacgcctcaagtgtggtggtttcatttttgctttccgtatgaaccatacaatgagtgatggatcaggtatgcttcaattcttgaatgcctta |
181 |
Q |
| |
|
|||||||||||||||||||||||||||||| || |||||| | ||||||||||||||| ||||||||| ||| || |||||||||||||||| ||||||| |
|
|
| T |
14878759 |
gcaggtaacacgcctcaagtgtggtggttttatctttgctattcgtatgaaccatacattgagtgatgcatcgggcatgcttcaattcttgagtgcctta |
14878660 |
T |
 |
| Q |
182 |
ggagagatatctcgtgggatgagcaaaccttcaatctcaccggtgtggtgtagagagcttcttaa |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||| |
|
|
| T |
14878659 |
ggagagatatctcgtgggatgagcaaaccttcaatctcaccggtgtggagcagagagcttcttaa |
14878595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 82 - 243
Target Start/End: Complemental strand, 14786905 - 14786744
Alignment:
| Q |
82 |
gcaggtaacacgcctcaagtgtggtggtttcatttttgctttccgtatgaaccatacaatgagtgatggatcaggtatgcttcaattcttgaatgcctta |
181 |
Q |
| |
|
||||||||| || |||||||||||||||||||| |||||| | ||| | ||||||||||| || || ||||||| | || ||||||| | ||||||| |
|
|
| T |
14786905 |
gcaggtaacgcgtctcaagtgtggtggtttcatatttgctcttcgtctaaaccatacaattagcgactcatcaggtttatttaaattcttaagtgcctta |
14786806 |
T |
 |
| Q |
182 |
ggagagatatctcgtgggatgagcaaaccttcaatctcaccggtgtggtgtagagagcttct |
243 |
Q |
| |
|
||||| |||||||| || |||| | ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14786805 |
ggagaaatatctcgcggaatgaacgaaccttcaatctcaccggtgtggtgtagagagcttct |
14786744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 84 - 243
Target Start/End: Complemental strand, 14767814 - 14767655
Alignment:
| Q |
84 |
aggtaacacgcctcaagtgtggtggtttcatttttgctttccgtatgaaccatacaatgagtgatggatcaggtatgcttcaattcttgaatgccttagg |
183 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||| | ||| | |||||||||||||| |||| | | ||| || | |||||| ||| ||||||||| |
|
|
| T |
14767814 |
aggtaacacgcctcaagtgcggtggtttcatttttgctcttcgtctaaaccatacaatgagcgatgcagcgggtttggtccaattcatgagtgccttagg |
14767715 |
T |
 |
| Q |
184 |
agagatatctcgtgggatgagcaaaccttcaatctcaccggtgtggtgtagagagcttct |
243 |
Q |
| |
|
|| || ||| | ||||||| |||||||||||| |||||| ||| ||| |||||||| |
|
|
| T |
14767714 |
tgaaatttcttgcgggatgaatgaaccttcaatcttaccggtatggcatagggagcttct |
14767655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 82 - 249
Target Start/End: Complemental strand, 14873897 - 14873730
Alignment:
| Q |
82 |
gcaggtaacacgcctcaagtgtggtggtttcatttttgctttccgtatgaaccatacaatgagtgatggatcaggtatgcttcaattcttgaatgcctta |
181 |
Q |
| |
|
|||||||||||| | || || |||||||||||||||||| | ||| | |||||||| |||||||| | | ||| || | |||||| ||||||||||| |
|
|
| T |
14873897 |
gcaggtaacacgtttgaaatgcggtggtttcatttttgctcttcgtctaaaccatacgatgagtgacgctgctggtttggtccaattcatgaatgcctta |
14873798 |
T |
 |
| Q |
182 |
ggagagatatctcgtgggatgagcaaaccttcaatctcaccggtgtggtgtagagagcttcttaacgc |
249 |
Q |
| |
|
|| | || || |||||||||| |||||||||||||||||| || ||| |||||||||||| ||||| |
|
|
| T |
14873797 |
ggcaaaatttcacgtgggatgaacaaaccttcaatctcaccagtatggcatagagagcttctaaacgc |
14873730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0042 (Bit Score: 81; Significance: 3e-38; HSPs: 1)
Name: scaffold0042
Description:
Target: scaffold0042; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 41 - 237
Target Start/End: Complemental strand, 84861 - 84665
Alignment:
| Q |
41 |
tcattagttagttcattcatatacatgaattgttaccatgcgcaggtaacacgcctcaagtgtggtggtttcatttttgctttccgtatgaaccatacaa |
140 |
Q |
| |
|
|||||| ||| |||||||| || | ||||||| |||||| |||||||||||||||||| ||| | ||||||||||||||| | ||| | |||||||||| |
|
|
| T |
84861 |
tcattaattatttcattcacatgctggaattgtaaccatgtgcaggtaacacgcctcaaatgtagaggtttcatttttgctcttcgtttcaaccatacaa |
84762 |
T |
 |
| Q |
141 |
tgagtgatggatcaggtatgcttcaattcttgaatgccttaggagagatatctcgtgggatgagcaaaccttcaatctcaccggtgtggtgtagaga |
237 |
Q |
| |
|
||| ||||||||||||||| |||||||| ||| ||| |||| ||| ||||||| || ||||| ||||||||||||||||| |||||||| ||||| |
|
|
| T |
84761 |
tgactgatggatcaggtatagttcaattcatgagtgctttagcagaaatatctcagggtatgagaaaaccttcaatctcaccagtgtggtgcagaga |
84665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0502 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: scaffold0502
Description:
Target: scaffold0502; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 83 - 151
Target Start/End: Complemental strand, 10390 - 10322
Alignment:
| Q |
83 |
caggtaacacgcctcaagtgtggtggtttcatttttgctttccgtatgaaccatacaatgagtgatgga |
151 |
Q |
| |
|
||||||||||| ||||| ||||||||||||| ||||||| || ||||| |||||||||||||||||| |
|
|
| T |
10390 |
caggtaacacgactcaaaggtggtggtttcatctttgcttatcgcatgaatcatacaatgagtgatgga |
10322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 35; Significance: 0.00000000009; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 83 - 153
Target Start/End: Original strand, 47256457 - 47256527
Alignment:
| Q |
83 |
caggtaacacgcctcaagtgtggtggtttcatttttgctttccgtatgaaccatacaatgagtgatggatc |
153 |
Q |
| |
|
||||| ||||| |||||||||||||||||||| || || || || |||||||||||||| |||||||||| |
|
|
| T |
47256457 |
caggttacacgtctcaagtgtggtggtttcatattggccttgagtttgaaccatacaatgggtgatggatc |
47256527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 83 - 149
Target Start/End: Original strand, 47242329 - 47242395
Alignment:
| Q |
83 |
caggtaacacgcctcaagtgtggtggtttcatttttgctttccgtatgaaccatacaatgagtgatg |
149 |
Q |
| |
|
||||| ||||| |||||||||||||||||||| || || || || |||||||||||||| |||||| |
|
|
| T |
47242329 |
caggtcacacgtctcaagtgtggtggtttcatattggccttgagtgtgaaccatacaatgggtgatg |
47242395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 83 - 149
Target Start/End: Original strand, 32731000 - 32731066
Alignment:
| Q |
83 |
caggtaacacgcctcaagtgtggtggtttcatttttgctttccgtatgaaccatacaatgagtgatg |
149 |
Q |
| |
|
||||| ||||| |||||||||||||||||||| || || || || |||||||||||||| |||||| |
|
|
| T |
32731000 |
caggtcacacgtctcaagtgtggtggtttcatattggccttgagtgtgaaccatacaatgggtgatg |
32731066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University