View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18906_high_6 (Length: 293)
Name: NF18906_high_6
Description: NF18906
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18906_high_6 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 106; Significance: 4e-53; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 53 - 176
Target Start/End: Complemental strand, 40368988 - 40368868
Alignment:
| Q |
53 |
ttagataactcataacaccaatttgatcataaattaagaggaaaatcatatggtctagttattaaatttcttatctatttaaagttttgaaaaatttaca |
152 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40368988 |
ttagataactcataacaccaatttgat---aaattaagaggaaaatcatatggtctagtttttaaatttcttatctatttaaagttttgaaaaatttaca |
40368892 |
T |
|
| Q |
153 |
ataatatttgtaagtttagtggat |
176 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
40368891 |
ataatatttgtaagtttagtggat |
40368868 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University