View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18906_low_5 (Length: 299)
Name: NF18906_low_5
Description: NF18906
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18906_low_5 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 252; Significance: 1e-140; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 17 - 288
Target Start/End: Complemental strand, 7108524 - 7108253
Alignment:
| Q |
17 |
aggaacttcatttggagtggggacattgagaagaggaaattagtcattgtggcatggaaaaaatttgtaagccattagaggagggagggttaggtattag |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
7108524 |
aggaacttcatttggagtggggacattgagaagaggaaattagtcattgtggcatgaaaaaaatttgtaagccattagaggaaggagggttaggtattag |
7108425 |
T |
|
| Q |
117 |
atatctaatccatcttaatgaagcttataatcttaagctttgttgagagaatggcgtcttctgatacggatcgggcaaagatgttaaggtctagagtttt |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
7108424 |
atatctaatccatcttaatgaagcttataatcttaagctttgttgggagaatggcgtcttctgatacggattgggcaaagatgttaaggtctagagtttt |
7108325 |
T |
|
| Q |
217 |
aaaaaacgatagatgtatttcttatcatattttctcctctttatcgagtagttttaaaagtgagtataatct |
288 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7108324 |
aaaaaatgatagatgtatttcttatcatattttctcctctttatcgagtagttttaaaagtgagtataatct |
7108253 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University