View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18907_high_10 (Length: 259)
Name: NF18907_high_10
Description: NF18907
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18907_high_10 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 188; Significance: 1e-102; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 18 - 229
Target Start/End: Complemental strand, 2554624 - 2554414
Alignment:
| Q |
18 |
gatttgtctctatttcaagtgatttatcaatgggaaatattgtggggatgagagaatgttttagagagtttttgagtggaggaaaaaccaagtatatata |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
2554624 |
gatttgtctctatttcaagtgatttatcaatgggaaatagtgtggggatgagagaatgttttagagagtttttgagtggaggaaaa-ccaagtatatata |
2554526 |
T |
 |
| Q |
118 |
gtgttcttttcatatgcaaagaggcattactcgcatgtgtgagcaaacacaggcagatttatgggtttagacttcatcgtatgcgtgaggcctatatgga |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
2554525 |
gtgttcttttcatatgcaaagaggcattactcgcatgtgtgagcaaacacgggcaaatttatgggtttagacttcattgtatgcgtgaggcctatatgga |
2554426 |
T |
 |
| Q |
218 |
tcacatatggga |
229 |
Q |
| |
|
|||||||||||| |
|
|
| T |
2554425 |
tcacatatggga |
2554414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 222 - 257
Target Start/End: Complemental strand, 2553701 - 2553666
Alignment:
| Q |
222 |
atatgggaacaatgtcatgggttcaaggtttcattt |
257 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
2553701 |
atatgggaacaatgtcatgggttcaaggtttcattt |
2553666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University