View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18907_high_10 (Length: 259)

Name: NF18907_high_10
Description: NF18907
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18907_high_10
NF18907_high_10
[»] chr2 (2 HSPs)
chr2 (18-229)||(2554414-2554624)
chr2 (222-257)||(2553666-2553701)


Alignment Details
Target: chr2 (Bit Score: 188; Significance: 1e-102; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 18 - 229
Target Start/End: Complemental strand, 2554624 - 2554414
Alignment:
18 gatttgtctctatttcaagtgatttatcaatgggaaatattgtggggatgagagaatgttttagagagtttttgagtggaggaaaaaccaagtatatata 117  Q
    ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||    
2554624 gatttgtctctatttcaagtgatttatcaatgggaaatagtgtggggatgagagaatgttttagagagtttttgagtggaggaaaa-ccaagtatatata 2554526  T
118 gtgttcttttcatatgcaaagaggcattactcgcatgtgtgagcaaacacaggcagatttatgggtttagacttcatcgtatgcgtgaggcctatatgga 217  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||| ||||||||||||||||||||||    
2554525 gtgttcttttcatatgcaaagaggcattactcgcatgtgtgagcaaacacgggcaaatttatgggtttagacttcattgtatgcgtgaggcctatatgga 2554426  T
218 tcacatatggga 229  Q
    ||||||||||||    
2554425 tcacatatggga 2554414  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 222 - 257
Target Start/End: Complemental strand, 2553701 - 2553666
Alignment:
222 atatgggaacaatgtcatgggttcaaggtttcattt 257  Q
    ||||||||||||||||||||||||||||||||||||    
2553701 atatgggaacaatgtcatgggttcaaggtttcattt 2553666  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University