View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18907_high_15 (Length: 210)
Name: NF18907_high_15
Description: NF18907
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18907_high_15 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 149; Significance: 7e-79; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 149; E-Value: 7e-79
Query Start/End: Original strand, 14 - 189
Target Start/End: Complemental strand, 46696585 - 46696407
Alignment:
| Q |
14 |
aagaatatggattgatttgcaactgatatatactgccgacataggaggagaactgaaaattaagtaaacataaatgaaacaatttttaa---aatgacaa |
110 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||| |
|
|
| T |
46696585 |
aagaatatggattgatttgcatctgatatatactgccgacataggaggagaactgaaaattaagtaaacataaatgaaacaatttttaaaataataacaa |
46696486 |
T |
|
| Q |
111 |
tatcataatgaattaaaggaagcaaaccagcactcaattcaaagaacttggtcataataggctctagtatgctgcatag |
189 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
46696485 |
tatcataatgaattaaaggaaacaaaccagcactcaattcaaagaacttagtcataataggctctagtatgctgcatag |
46696407 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University