View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18907_low_14 (Length: 263)

Name: NF18907_low_14
Description: NF18907
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18907_low_14
NF18907_low_14
[»] scaffold0022 (1 HSPs)
scaffold0022 (18-253)||(65732-65965)


Alignment Details
Target: scaffold0022 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: scaffold0022
Description:

Target: scaffold0022; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 18 - 253
Target Start/End: Original strand, 65732 - 65965
Alignment:
18 acttgcaccatagaagaatccatagctgtggaagaatgaatgggtttgtgctaaaagagatttcgaggaatgaagcaaaaatatgttggaatttagaaga 117  Q
    ||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||    
65732 acttgcaccatagaagaatccataggtgtggaagaatgaatgggtttgtgttaaaagagatttcgaggaatgaagcaaaaatgtgttggaatttagaaga 65831  T
118 ggttgtgannnnnnnnnnnnnnnnnnnnngaaggagaagaggtagtgatttttaacaatggttgtttttattttgatttataagagatttttaatgaagg 217  Q
    ||||||||                     ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
65832 ggttgtgatttttatgttttttttttt--gaaagagaagaggtagtgatttttaacaatggttgtttttattttgatttataagagatttttaatgaagg 65929  T
218 ttgttaaaggttcggtttcttgtgtgatggtgatga 253  Q
    ||||||||||||||||||||||||||||||||||||    
65930 ttgttaaaggttcggtttcttgtgtgatggtgatga 65965  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University