View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18907_low_14 (Length: 263)
Name: NF18907_low_14
Description: NF18907
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18907_low_14 |
 |  |
|
| [»] scaffold0022 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0022 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: scaffold0022
Description:
Target: scaffold0022; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 18 - 253
Target Start/End: Original strand, 65732 - 65965
Alignment:
| Q |
18 |
acttgcaccatagaagaatccatagctgtggaagaatgaatgggtttgtgctaaaagagatttcgaggaatgaagcaaaaatatgttggaatttagaaga |
117 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
65732 |
acttgcaccatagaagaatccataggtgtggaagaatgaatgggtttgtgttaaaagagatttcgaggaatgaagcaaaaatgtgttggaatttagaaga |
65831 |
T |
 |
| Q |
118 |
ggttgtgannnnnnnnnnnnnnnnnnnnngaaggagaagaggtagtgatttttaacaatggttgtttttattttgatttataagagatttttaatgaagg |
217 |
Q |
| |
|
|||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
65832 |
ggttgtgatttttatgttttttttttt--gaaagagaagaggtagtgatttttaacaatggttgtttttattttgatttataagagatttttaatgaagg |
65929 |
T |
 |
| Q |
218 |
ttgttaaaggttcggtttcttgtgtgatggtgatga |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
65930 |
ttgttaaaggttcggtttcttgtgtgatggtgatga |
65965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University