View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18907_low_17 (Length: 235)
Name: NF18907_low_17
Description: NF18907
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18907_low_17 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 139; Significance: 7e-73; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 1 - 220
Target Start/End: Complemental strand, 49607515 - 49607301
Alignment:
| Q |
1 |
atgcaatatttgcgtcgtaatatgagtgcttgaaacattatagatgcggtaatagtatggcattggcaagggttcaatatattatataatttcccgtttg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||| |
|
|
| T |
49607515 |
atgcaatatttgcgtcgtaatatgagtgcttgaaacattatagatgcggtaatagtatggca------agggtttaatatattatataatttcccgtttg |
49607422 |
T |
|
| Q |
101 |
aaggtggtgctcttgnnnnnnnnn-ggactcatcaaaccatttgcattagtgcatcaaatgcttaggttattttgataaagaaaaacctattcctaccac |
199 |
Q |
| |
|
|| |||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||| ||||||| |
|
|
| T |
49607421 |
aaagtggtgctcttgaaaaaaaaatggacccatcaaaccatttgcattagtgcatcaaatgcttaggttattgtgataaaaaaaaacctattgctaccac |
49607322 |
T |
|
| Q |
200 |
cttcatggatgaagaatcata |
220 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
49607321 |
cttcatggatgaagaatcata |
49607301 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University