View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18907_low_18 (Length: 234)
Name: NF18907_low_18
Description: NF18907
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18907_low_18 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 19 - 216
Target Start/End: Original strand, 9546342 - 9546539
Alignment:
| Q |
19 |
tatcttcaccaacatgtcatcaaactgttctaacactagtttccataacggctttcccttctcttttgctagctcattccaaccgtatttctcacgccgc |
118 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9546342 |
tatcttcaccaacatgtcatcaaattgttctaacactagtttccataacggctttcccttctcttttgctagctcattccaaccgtatttctcacgccgc |
9546441 |
T |
|
| Q |
119 |
ttctgaacctcattagaactcaaacccttttccagtttcacaccatactcttccaagcactcatcaactgaccatgaccatgcagggaatggcttttc |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9546442 |
ttctgaacctcattagaactcaaacccttttccagtttcacaccatactcttccaagcactcatcaactgaccatgaccatgcagggaatggcttttc |
9546539 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University