View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18907_low_20 (Length: 210)

Name: NF18907_low_20
Description: NF18907
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18907_low_20
NF18907_low_20
[»] chr4 (1 HSPs)
chr4 (14-189)||(46696407-46696585)


Alignment Details
Target: chr4 (Bit Score: 149; Significance: 7e-79; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 149; E-Value: 7e-79
Query Start/End: Original strand, 14 - 189
Target Start/End: Complemental strand, 46696585 - 46696407
Alignment:
14 aagaatatggattgatttgcaactgatatatactgccgacataggaggagaactgaaaattaagtaaacataaatgaaacaatttttaa---aatgacaa 110  Q
    ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||   ||| ||||    
46696585 aagaatatggattgatttgcatctgatatatactgccgacataggaggagaactgaaaattaagtaaacataaatgaaacaatttttaaaataataacaa 46696486  T
111 tatcataatgaattaaaggaagcaaaccagcactcaattcaaagaacttggtcataataggctctagtatgctgcatag 189  Q
    ||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||    
46696485 tatcataatgaattaaaggaaacaaaccagcactcaattcaaagaacttagtcataataggctctagtatgctgcatag 46696407  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University