View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18908_high_19 (Length: 246)
Name: NF18908_high_19
Description: NF18908
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18908_high_19 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 51 - 222
Target Start/End: Complemental strand, 3019194 - 3019011
Alignment:
| Q |
51 |
ctttcatgtgcgtgtcccgtactcttctccaatcctcactcatagtactactatatgtaatgtaactgtaata------------ttattatcattcatt |
138 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
3019194 |
ctttcatgtgcgtgtcccgtactcttctccaatcctcactcatagtactactatatgtaatgtaactgtaataatattattattattattatcattcatt |
3019095 |
T |
 |
| Q |
139 |
gagtatcacacatggaggttaagctttgcaaagacaagcaccaaagagaaatggtggataaatttgctcaagtactctatgcca |
222 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
3019094 |
gagtatcacacatggaggttaagatttgcaaagacaagcaccaaagagaaatggtggataactttgctcaagtactctatgcca |
3019011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University