View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18908_low_11 (Length: 403)
Name: NF18908_low_11
Description: NF18908
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18908_low_11 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 318; Significance: 1e-179; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 318; E-Value: 1e-179
Query Start/End: Original strand, 41 - 385
Target Start/End: Original strand, 30727100 - 30727443
Alignment:
| Q |
41 |
ggtagctggaaaagtattgttataaggtagcttctgtattttgcttgcttttagtactactaaactgaaccttttctgttgtttttatttgcttgctaaa |
140 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30727100 |
ggtagctggaaaagtattgttataaggtagcttctgtattttgcttgcttttagtact---aaactgaaccttttctgttgtttttatttgcttgctaaa |
30727196 |
T |
 |
| Q |
141 |
caggccctaaggggggtcccatttatgaaactgttttgcatttatagaagatttgattgattcaccatggtaaaggagataaataacggttatgactgag |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30727197 |
caggccctaaggggggtcccatttatgaaactgttttgcatttatagaagatttgattgattcaccatggtaaaggagataaataacggttatgactgag |
30727296 |
T |
 |
| Q |
241 |
tgtgataaaatactatatagtaaactgtttaacttaagtttccaccaagctcatatggtatataatactgttagtctgttactactg--tggtagtgtaa |
338 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
30727297 |
tgtgataaaatactatatagtaaactgtttatcttaagtttccaccaagctcatatggtatataatactgttagtctgttactactgtctggtagtgtaa |
30727396 |
T |
 |
| Q |
339 |
cttaacttcaactatttagtatgtacctaaagtgtgtgccataattt |
385 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30727397 |
cttaacttcaactatttagtatgtacctaaagtgtgtgccataattt |
30727443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University