View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18908_low_14 (Length: 327)
Name: NF18908_low_14
Description: NF18908
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18908_low_14 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 147; Significance: 2e-77; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 147; E-Value: 2e-77
Query Start/End: Original strand, 154 - 304
Target Start/End: Complemental strand, 35146307 - 35146157
Alignment:
| Q |
154 |
aaatcaacgaaaaccaaagcctgcatagaaacttgaattcttgaacagaaaaccgagaatggcgacaaataactcagccatgaaaaaatcgagggagaaa |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
35146307 |
aaatcaacgaaaaccaaagcctgcatagaaacttgaattcttgaacagaaaaccgagaatggcaacaaataactcagccatgaaaaaatcgagggagaaa |
35146208 |
T |
|
| Q |
254 |
tcgaggggctccgattctcctgccatgaaaaagtcatggtcaagaggctcc |
304 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35146207 |
tcgaggggctccgattctcctgccatgaaaaagtcatggtcaagaggctcc |
35146157 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 1 - 53
Target Start/End: Complemental strand, 35146470 - 35146418
Alignment:
| Q |
1 |
tatggattgacgcacacatgtcatgctttttattgcactaaatacacacacaa |
53 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35146470 |
tatggattgacgcacacatgtcatgctttttattgcactaaatacacacacaa |
35146418 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University