View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18908_low_20 (Length: 249)
Name: NF18908_low_20
Description: NF18908
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18908_low_20 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 1 - 245
Target Start/End: Original strand, 1510984 - 1511230
Alignment:
| Q |
1 |
ttagaagcctgaagtgaaacgcaaattctcaagtcaacctccttctcttctttggtttctttcttgtttgaataaaaaagaatacaacatgaaactagtt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1510984 |
ttagaagcctgaagtgaaacgcaaattctcaagtcaacctccttttcttctttggtttctttcttgtttgaataaaaaagaatacaacatgaaactagtt |
1511083 |
T |
|
| Q |
101 |
gaaaccgg--ataaatataactaacgcggtttaaaactttaaatcggtttaaaccaaaccaaaattgatttgagaaattgactggtttttattaaaatgg |
198 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||| | |
|
|
| T |
1511084 |
gaaaccggggataaatataactaacgcggtttaaaactttaaatcggtttaaaccaaaccaaaattgatttgagaaattaacaggtttttattaaaatag |
1511183 |
T |
|
| Q |
199 |
tttttgagaactgaaccaaacgaaccctaattgtgattcatttcagt |
245 |
Q |
| |
|
|||||||||||||||||||||| ||||||| ||||||||| |||||| |
|
|
| T |
1511184 |
tttttgagaactgaaccaaacggaccctaaatgtgattcaattcagt |
1511230 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 184 - 220
Target Start/End: Original strand, 44198471 - 44198507
Alignment:
| Q |
184 |
tttttattaaaatggtttttgagaactgaaccaaacg |
220 |
Q |
| |
|
|||||||||||||||||||| | |||||||||||||| |
|
|
| T |
44198471 |
tttttattaaaatggtttttaaaaactgaaccaaacg |
44198507 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University