View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18909_high_4 (Length: 393)
Name: NF18909_high_4
Description: NF18909
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18909_high_4 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 210; Significance: 1e-115; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 13 - 259
Target Start/End: Complemental strand, 2177475 - 2177229
Alignment:
| Q |
13 |
ggagaggaaagaaaaaatatgcttgtgtggagtccacgtgtctatgtatcatagcaaagacatgtatgacttttctcttccttgacccctaggtcacttc |
112 |
Q |
| |
|
|||||||||||| ||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2177475 |
ggagaggaaagagaaaatgtgcttgtgtgggatccacgtgtctatgtatcatagcaaagacatgtatgacttttctcttccttgacccctaggtcacttc |
2177376 |
T |
|
| Q |
113 |
attgatattgagcagnnnnnnnttcaggtaattagtccatgaccctttgtgccccgccaccctagacatatcgatcatatgcttatccttatatcatatc |
212 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2177375 |
attgatattgagcagaaaaaaattcaggtaattagtccatgaccctttgtgccccgccaccctagacatatcgatcatatgcttatccttatatcatatc |
2177276 |
T |
|
| Q |
213 |
atatacttcataatcaactactataaattcactcttctatgtccata |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2177275 |
atatacttcataatcaactactataaattcactcttctatgtccata |
2177229 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 316 - 393
Target Start/End: Complemental strand, 2177173 - 2177096
Alignment:
| Q |
316 |
aaacataaaaccatgatcactaccatattgtttgattgtcttgaatttcttagtagaaaaatatcatatgaaaaatta |
393 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2177173 |
aaacataaaaccatgatcactaccatattgtttgattgtcttgaatttcttagtagaaaaatatcatatgaaaaatta |
2177096 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University