View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18909_low_5 (Length: 393)

Name: NF18909_low_5
Description: NF18909
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18909_low_5
NF18909_low_5
[»] chr5 (2 HSPs)
chr5 (13-259)||(2177229-2177475)
chr5 (316-393)||(2177096-2177173)


Alignment Details
Target: chr5 (Bit Score: 210; Significance: 1e-115; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 13 - 259
Target Start/End: Complemental strand, 2177475 - 2177229
Alignment:
13 ggagaggaaagaaaaaatatgcttgtgtggagtccacgtgtctatgtatcatagcaaagacatgtatgacttttctcttccttgacccctaggtcacttc 112  Q
    |||||||||||| ||||| |||||||||||  ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2177475 ggagaggaaagagaaaatgtgcttgtgtgggatccacgtgtctatgtatcatagcaaagacatgtatgacttttctcttccttgacccctaggtcacttc 2177376  T
113 attgatattgagcagnnnnnnnttcaggtaattagtccatgaccctttgtgccccgccaccctagacatatcgatcatatgcttatccttatatcatatc 212  Q
    |||||||||||||||       ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2177375 attgatattgagcagaaaaaaattcaggtaattagtccatgaccctttgtgccccgccaccctagacatatcgatcatatgcttatccttatatcatatc 2177276  T
213 atatacttcataatcaactactataaattcactcttctatgtccata 259  Q
    |||||||||||||||||||||||||||||||||||||||||||||||    
2177275 atatacttcataatcaactactataaattcactcttctatgtccata 2177229  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 316 - 393
Target Start/End: Complemental strand, 2177173 - 2177096
Alignment:
316 aaacataaaaccatgatcactaccatattgtttgattgtcttgaatttcttagtagaaaaatatcatatgaaaaatta 393  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2177173 aaacataaaaccatgatcactaccatattgtttgattgtcttgaatttcttagtagaaaaatatcatatgaaaaatta 2177096  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University