View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18911_high_4 (Length: 436)
Name: NF18911_high_4
Description: NF18911
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18911_high_4 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 379; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 379; E-Value: 0
Query Start/End: Original strand, 1 - 419
Target Start/End: Complemental strand, 28641725 - 28641307
Alignment:
| Q |
1 |
cgccctgattgcccaccagctaatttcacctccaccaccacttcttccaccactcttgatttctcagcccatcataacgtccctgacccaccagaaaccg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
28641725 |
cgccctgattgcccaccagctaatttcacctccaccaccacttcttccaccactcttgatttctcagcccatcataacgtccccgacccaccagaaacct |
28641626 |
T |
 |
| Q |
101 |
cagagcgtgttacccacgcgccggtttgtgatgttgctttatcggagtatactccgtgcgaggacacgcagcgatcgttgaaatttcctcgggagaattt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
28641625 |
cagagcgtgttacccacgcgccggtttgtgatgttgctttatcggagtatactccgtgcgaggacacacagcgatcgttgaaatttcctcgggagaattt |
28641526 |
T |
 |
| Q |
201 |
aatttatcgagagagacactgtccggaaaaagaggaggttctccggtgtcggataccggcaccgtatggctaccgcgttccgccgcggtggccggagagc |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28641525 |
aatttatcgagagagacactgtccggaaaaagaggaggttctccggtgtcggataccggcaccgtatggctaccgcgttccgccgcggtggccggagagc |
28641426 |
T |
 |
| Q |
301 |
cgtgattgggcttggtatgctaatgtgccacataaagaattgacgattgagnnnnnnnnccagaattgggttcattttgaaggtgaccggttcaggtttc |
400 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28641425 |
cgtgattgggcttggtatgctaatgtgccacataaagaattgacgattgagaaaaaaaaccagaattgggttcattttgaaggtgaccggttcaggtttc |
28641326 |
T |
 |
| Q |
401 |
ctggtggtgggactatgtt |
419 |
Q |
| |
|
||||||||||||| ||||| |
|
|
| T |
28641325 |
ctggtggtgggaccatgtt |
28641307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 34; Significance: 0.0000000006; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 286 - 335
Target Start/End: Complemental strand, 12404600 - 12404551
Alignment:
| Q |
286 |
cggtggccggagagccgtgattgggcttggtatgctaatgtgccacataa |
335 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| ||||| |||||||| |
|
|
| T |
12404600 |
cggtggccggagagccgtgacggggcttggtatgcaaatgttccacataa |
12404551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University