View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18911_high_7 (Length: 276)
Name: NF18911_high_7
Description: NF18911
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18911_high_7 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 90; Significance: 1e-43; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 19 - 129
Target Start/End: Complemental strand, 492049 - 491943
Alignment:
| Q |
19 |
agtttgtgtttaagccaattgagcacatctggatcagaaaaaactcaacagtgatgaagcctagagagagcatgtcaaagattcttataatgcaatgaag |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
492049 |
agtttgtgtttaagccaattgagcacatctggatcagaaaaaactcaacagtgatgaagcct----agagcatgtcaaagattcttataatgcaatgaag |
491954 |
T |
|
| Q |
119 |
gaatgaatgtt |
129 |
Q |
| |
|
||||| ||||| |
|
|
| T |
491953 |
gaatgtatgtt |
491943 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 215 - 276
Target Start/End: Complemental strand, 491863 - 491802
Alignment:
| Q |
215 |
tatacatcatcaacctttcccgtttctcactcattatctggaattcctccctcgacctctct |
276 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
491863 |
tatacatcatcaaccgttcccgtttctcactcattatctggaattcctccctcgacctctct |
491802 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University